algorithms bitplane imaris 9 2 oxford instruments rrid scr 007370 fiji nih rrid scr 002285 clearmap 3 1 kirst (Oxford Instruments)
99
Structured Review
Oxford Instruments
algorithms bitplane imaris 9 2 oxford instruments rrid scr 007370 fiji nih rrid scr 002285 clearmap 3 1 kirst
Algorithms Bitplane Imaris 9 2 Oxford Instruments Rrid Scr 007370 Fiji Nih Rrid Scr 002285 Clearmap 3 1 Kirst, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44287 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imaris+bitplane/Imaris/pm41985458-259-279-280
Average 99 stars, based on 44287 article reviews
Algorithms Bitplane Imaris 9 2 Oxford Instruments Rrid Scr 007370 Fiji Nih Rrid Scr 002285 Clearmap 3 1 Kirst, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44287 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imaris+bitplane/Imaris/pm41985458-259-279-280
Average 99 stars, based on 44287 article reviews
algorithms bitplane imaris 9 2 oxford instruments rrid scr 007370 fiji nih rrid scr 002285 clearmap 3 1 kirst - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Recombinant:Article Title: Hippocampal engram networks for fear memory recruit new synapses and modify pre-existing synapses in vivo. Article Snippet: .. Korea N/A Recombinant DNA pAAV-Fos-rtTA Choi et al.8 Addgene 120309 pAAV-CamKll-iCre Choi et al.8 N/A pAAV-EF1a-DIO-myriRFP670V5P2A-post-eGRASP Choi et al.8 Addgene 111585 pAAV-TRE3G-myrmScarlet-I This paper N/A pAAV-CamKll-cyan pre-eGRASP Choi et al.8 Addgene 111586 pAAV-TRE3G-yellow pre-eGRASP Choi et al.8 N/A Software and Article Title: An HNF1α truncation associated with maturity-onset diabetes of the young impairs pancreatic progenitor differentiation by antagonizing HNF1β function Article Snippet: .. This study N/A Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Addgene (Ran et al., 2013) plasmid #48138 pUltra backbone Addgene plasmid #24129 pMD2.G Addgene plasmid #12259 psPAX2 Addgene plasmid #12260 Software and Article Title: Neuroblastoma differentiation in vivo excludes cranial tumors. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-neurofilament heavy chain Genetex Cat# GTX110065; RRID: AB_1950985 Rabbit polyclonal anti-neurofilament heavy polypeptide Abcam Cat# ab8135; RRID: AB_306298 Goat polyclonal anti-RFP Rockland Cat# 200-101-379; RRID: AB_2744552 Rabbit polyclonal anti-ITSN1 antibody Russo and O’Bryan, 2012; Laboratory of John P. O’Bryan, Medical University of South Carolina N/A Mouse monoclonal anti-b-tubulin antibody Sigma-Aldrich Cat# T4026; RRID: AB_477577 Alexa Fluor 488 donkey anti-mouse IgG (H+L) ThermoFisher REF# A21202; RRID: AB_141607 Alexa Fluor 488 donkey anti-rabbit IgG (H+L) ThermoFisher REF# A21206; RRID: AB_2535792 Alexa Fluor 647 donkey anti-goat IgG (H+L) ThermoFisher REF# A21447; RRID: AB_2535864 Alexa Fluor 647 donkey anti-mouse IgG (H+L) ThermoFisher REF# A31571; RRID: AB_162542 Alexa Fluor 647 donkey anti-rabbit IgG (H+L) ThermoFisher REF# A31573; RRID: AB_2536183 Biological samples Patient-derived xenografts (PDXs) Children’s Oncology Group Childhood Cancer Repository COG557x; COG636x Chemicals, peptides, and recombinant proteins Lipofectamine 3000 Transfection Reagent Invitrogen Cat# L3000001 Retinoic acid Sigma-Aldrich Cat# R2625 ANA-12 Sigma-Aldrich Cat# SML0209 K252a Sigma-Aldrich Cat# K1639 LY294002 Sigma-Aldrich Cat# 440202 Wortmannin Sigma-Aldrich Cat# W1628 Agarose, low gelling temperature Sigma-Aldrich Cat# A0701 Tricaine/MS-222 Sigma-Aldrich Cat# A5040 Methyl cellulose Sigma-Aldrich Cat# M0512 BDNF human Sigma-Aldrich Cat# SRP3014 Triethanolamine Sigma-Aldrich Cat# 90279 Formamide Sigma-Aldrich Cat# F7503 DAPI Sigma-Aldrich Cat# D9542 Hoechst 34580 Invitrogen Cat# H21486 CellTracker CM-DiI Dye Invitrogen Cat# C7001 KnockOut DMEM Invitrogen Cat# 10829018 KnockOut Serum Replacement Invitrogen Cat# 10828028 N-2 Supplement Invitrogen Cat# 17502048 Critical commercial assays Hybridization Chain Reaction Probes and Hairpins Version 3 Molecular Instruments N/A Experimental models: Cell lines HEK293 Laboratory of John P. O’Bryan, Medical University of South Carolina N/A (Continued on next page) Developmental Cell 56, 2752–2764.e1–e6, October 11, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SK-N-AS Laboratory of John P. O’Bryan, Medical University of South Carolina N/A KELLY Laboratory of John P. O’Bryan, Medical University of South Carolina N/A SH-SY5Y Laboratory of Gerardo Morfini, University of Illinois at Chicago N/A IMR-5 Laboratory of John P. O’Bryan, Medical University of South Carolina N/A A375 American Type Culture Collection Cat# CRL-1619 OVCAR-8 Laboratory of Joanna E Burdette, University of Illinois at Chicago N/A GIMEN Biohippo Cat# 300179 Experimental models: Organisms/strains Zebrafish: AB wild-type ZIRC Cat# ZL1 Zebrafish: Tg(-4.9sox10:eGFP) Wada et al., 2005 ZFIN ID: ZDB-FISH-150901-15643 Mouse: C57BL/6J Jackson Labs Cat# 000664 Oligonucleotides Translation-blocking morpholino against BDNF: CCAGTCGTAAAGGAGACCATTCAGC Diekmann et al., 2009 N/A Control morpholino: CCTCTTACCTCAGTTACAATTTATA Gene Tools SKU:PCO-StandardControl-100 Recombinant DNA mCherry-Farnesyl-5 Laboratory of Michael Davidson, The Florida State University Addgene plasmid # 55045 mCherry-Lifeact-7 Laboratory of Michael Davidson, The Florida State University Addgene plasmid # 54491 GFP-AktPH Laboratory of Tobias Meyer, Stanford University (Haugh et al., 2000) N/A -2.2NEUROD1:eGFP This paper N/A murine ITSN1s-CFP This paper N/A Software and Article Title: YTHDF1-CLOCK axis contributes to pathogenesis of allergic airway inflammation through LLPS. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies METTL3 Abcam ab195352 RRID:AB_2721254 METTL14 Abcam ab220030 RRID:AB_2893210 WTAP ABclonal A14695 RRID:AB_2761570 YTHDF1 Abcam ab252346 RRID:AB_252346 YTHDF1 Servicebio GB111390 YTHDF2 Abcam ab246514 RRID:AB_2891213 YTHDF3 Abcam ab220161 RRID:AB_2868574 CD326 Abcam ab71916 RRID:AB_1603782 CLOCK ABclonal A7265 RRID:AB_2863594 CRY2 ABclonal A17465 RRID:AB_2769052 PER2 ABclonal A5107 RRID:AB_2863447 PER3 ABclonal A2219 RRID:AB_2862977 CREB1 ABclonal A11064 RRID:AB 2758389 FBXL3 Abcam Ab96645 RRID:AB 10679381 TSLP Servicebio GB111664 IL-25 Abcam Ab115672 RRID:AB 10902345 IL-33 Affinity DF8369 RRID:AB 2841633 NLRP3 Cell Signaling Technology 1510S NLRP3 Servicebio GB11300 IL-1b Abcam Ab234437 RRID:AB 2936228 Biological samples Human bronchial biopsies samples This study N/A Chemicals, peptides, and recombinant proteins TRIZOL reagent Thermo Fisher scientific 15596018 LipoFectamine 3000 Thermo Fisher scientific L3000150 HaltTM protease and phosphatase inhibitor cocktail Thermo Fisher scientific MedChemExpress 78440 HY-K0021 Triton X-100 Beyotime P0096 RIPA Beyotime P0013B Magna RIPTM RNA-Binding Millipore 17–701 House Dust Mite Greer labs XPB82D3A25 PneumaCultTM -Ex Plus Medium STEMCELL Technologies 05040 PneumaCultTM-ALI Medium STEMCELL Technologies 05001 Pronase MedChemExpress HY-114158 penicillin/streptomycin Thermo Fisher Scientific 15140122 fungizone Thermo Fisher Scientific 15290026 Collagen I, Rat Tail Merck-Millipore 18080093 SYBRR Green PCR Master Mix Thermo Fisher Scientific 23225 DAPI Sigma-Aldrich D9542 Critical commercial assays FastQuant RT Kit TIANGEN KR106 PierceTM BCA Protein Assay Kit Thermo Fisher Scientific F6057 (Continued on next page) 16 Cell Reports 43, 113947, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data m6A-Seq, mRNA-Seq This study GSE256458, GSE256531 Experimental models: Cell lines Primary human AECs This study N/A Primary mouse AECs This study N/A BEAS-2B This study N/A Experimental models: Organisms/strains Mouse: C57/BL6 The Jackson Laboratory RRID:IMSR JAX:000664 Mouse: BALB/c The Jackson Laboratory RRID:MGI:2161072 Mouse: YTHDF1fl/fl N/A Mouse: Shhcre N/A Oligonucleotides Primers are listed in Table S2 This study N/A siRNA sequence are listed in Table S3 This study N/A Recombinant DNA YTHDF1-Flag This study N/A YTHDF1-YTH-mut This study N/A YTHDF1-C This study N/A BFP-YTHDF1-C This study N/A Software and Software:Article Title: Hippocampal engram networks for fear memory recruit new synapses and modify pre-existing synapses in vivo. Article Snippet: .. Korea N/A Recombinant DNA pAAV-Fos-rtTA Choi et al.8 Addgene 120309 pAAV-CamKll-iCre Choi et al.8 N/A pAAV-EF1a-DIO-myriRFP670V5P2A-post-eGRASP Choi et al.8 Addgene 111585 pAAV-TRE3G-myrmScarlet-I This paper N/A pAAV-CamKll-cyan pre-eGRASP Choi et al.8 Addgene 111586 pAAV-TRE3G-yellow pre-eGRASP Choi et al.8 N/A Software and Article Title: Activated somatostatin interneurons orchestrate memory microcircuits. Article Snippet: Report Article Title: An HNF1α truncation associated with maturity-onset diabetes of the young impairs pancreatic progenitor differentiation by antagonizing HNF1β function Article Snippet: .. This study N/A Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Addgene (Ran et al., 2013) plasmid #48138 pUltra backbone Addgene plasmid #24129 pMD2.G Addgene plasmid #12259 psPAX2 Addgene plasmid #12260 Software and Article Title: Neuroblastoma differentiation in vivo excludes cranial tumors. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-neurofilament heavy chain Genetex Cat# GTX110065; RRID: AB_1950985 Rabbit polyclonal anti-neurofilament heavy polypeptide Abcam Cat# ab8135; RRID: AB_306298 Goat polyclonal anti-RFP Rockland Cat# 200-101-379; RRID: AB_2744552 Rabbit polyclonal anti-ITSN1 antibody Russo and O’Bryan, 2012; Laboratory of John P. O’Bryan, Medical University of South Carolina N/A Mouse monoclonal anti-b-tubulin antibody Sigma-Aldrich Cat# T4026; RRID: AB_477577 Alexa Fluor 488 donkey anti-mouse IgG (H+L) ThermoFisher REF# A21202; RRID: AB_141607 Alexa Fluor 488 donkey anti-rabbit IgG (H+L) ThermoFisher REF# A21206; RRID: AB_2535792 Alexa Fluor 647 donkey anti-goat IgG (H+L) ThermoFisher REF# A21447; RRID: AB_2535864 Alexa Fluor 647 donkey anti-mouse IgG (H+L) ThermoFisher REF# A31571; RRID: AB_162542 Alexa Fluor 647 donkey anti-rabbit IgG (H+L) ThermoFisher REF# A31573; RRID: AB_2536183 Biological samples Patient-derived xenografts (PDXs) Children’s Oncology Group Childhood Cancer Repository COG557x; COG636x Chemicals, peptides, and recombinant proteins Lipofectamine 3000 Transfection Reagent Invitrogen Cat# L3000001 Retinoic acid Sigma-Aldrich Cat# R2625 ANA-12 Sigma-Aldrich Cat# SML0209 K252a Sigma-Aldrich Cat# K1639 LY294002 Sigma-Aldrich Cat# 440202 Wortmannin Sigma-Aldrich Cat# W1628 Agarose, low gelling temperature Sigma-Aldrich Cat# A0701 Tricaine/MS-222 Sigma-Aldrich Cat# A5040 Methyl cellulose Sigma-Aldrich Cat# M0512 BDNF human Sigma-Aldrich Cat# SRP3014 Triethanolamine Sigma-Aldrich Cat# 90279 Formamide Sigma-Aldrich Cat# F7503 DAPI Sigma-Aldrich Cat# D9542 Hoechst 34580 Invitrogen Cat# H21486 CellTracker CM-DiI Dye Invitrogen Cat# C7001 KnockOut DMEM Invitrogen Cat# 10829018 KnockOut Serum Replacement Invitrogen Cat# 10828028 N-2 Supplement Invitrogen Cat# 17502048 Critical commercial assays Hybridization Chain Reaction Probes and Hairpins Version 3 Molecular Instruments N/A Experimental models: Cell lines HEK293 Laboratory of John P. O’Bryan, Medical University of South Carolina N/A (Continued on next page) Developmental Cell 56, 2752–2764.e1–e6, October 11, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SK-N-AS Laboratory of John P. O’Bryan, Medical University of South Carolina N/A KELLY Laboratory of John P. O’Bryan, Medical University of South Carolina N/A SH-SY5Y Laboratory of Gerardo Morfini, University of Illinois at Chicago N/A IMR-5 Laboratory of John P. O’Bryan, Medical University of South Carolina N/A A375 American Type Culture Collection Cat# CRL-1619 OVCAR-8 Laboratory of Joanna E Burdette, University of Illinois at Chicago N/A GIMEN Biohippo Cat# 300179 Experimental models: Organisms/strains Zebrafish: AB wild-type ZIRC Cat# ZL1 Zebrafish: Tg(-4.9sox10:eGFP) Wada et al., 2005 ZFIN ID: ZDB-FISH-150901-15643 Mouse: C57BL/6J Jackson Labs Cat# 000664 Oligonucleotides Translation-blocking morpholino against BDNF: CCAGTCGTAAAGGAGACCATTCAGC Diekmann et al., 2009 N/A Control morpholino: CCTCTTACCTCAGTTACAATTTATA Gene Tools SKU:PCO-StandardControl-100 Recombinant DNA mCherry-Farnesyl-5 Laboratory of Michael Davidson, The Florida State University Addgene plasmid # 55045 mCherry-Lifeact-7 Laboratory of Michael Davidson, The Florida State University Addgene plasmid # 54491 GFP-AktPH Laboratory of Tobias Meyer, Stanford University (Haugh et al., 2000) N/A -2.2NEUROD1:eGFP This paper N/A murine ITSN1s-CFP This paper N/A Software and Article Title: An axon-T cell feedback loop enhances inflammation and axon degeneration. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Mouse PGP9.5 ProteinTech Group RRID:AB_2210497 Anti-Mouse Tyrosine Hydroxylase Millipore RRID:AB_390204 Anti-Mouse CD45 PE-Cy7 Biolegend RRID: AB_312979 Anti-Mouse CD3 Brilliant Violet 421 Biolegend RRID: AB_10900227 Anti-Mouse CD3 PE Biolegend RRID: AB_312663 Anti-Mouse gd TCR FITC Biolegend RRID: AB_313830 Anti-Mouse IL17A APC eBioscience RRID: AB_763580 Donkey anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen RRID: AB 2536183 Donkey anti-Chicken IgY (H + L) Highly Cross Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen RRID: AB_2921074 Donkey anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 790 Invitrogen RRID: AB_2534145 Donkey anti-Rat IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 Invitrogen RRID: AB 2910653 Goat anti-Armenian Hamster IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen RRID: AB_2925790 InVivoMAb anti-mouse CD8a BioXCell Cat: BE0004- InVivoMAb anti-mouse TCR g/d BioXCell Cat: BE0070 InVivoMAb rat IgG2a isotype control BioXCell Cat: BE0089 InVivoMAb polyclonal Armenian hamster IgG BioXCell Cat: BE0091 Fc Block eBioscience RRID: AB_468582 Chemicals, peptides, and recombinant proteins Imiquimod Cream Padagis Israel Pharmaceuticals Ltd N/A 6-Hydroxydopamine (6-OHDA) Sigma-Aldrich Cat: 162957-50MG Nair Hair Removal Lotion Church & Dwight Co., Inc. N/A PrimeScript RT Reagent Kit Takara Cat: RR047A PowerUp SYBR Green Master Mix for qPCR Thermo Fisher Scientific Cat: A25742 Dispase II Sigma Aldrich Cat: D4693-1G Collagenase IV Sigma-Aldrich Cat: V900893 Hyaluronidase Sigma-Aldrich Cat: H3884-100MG DNAse I Sigma-Aldrich Cat: D5025-15KU Phorbol-12-Myristate-13-Acetate Santa Cruz Biotechnology Cat: sc-3576 Ionomycin MP Biomedicals Inc Cat: 02155070-CF Norepinephrine Sigma-Aldrich Cat: A7256-1G Formoterol Sigma-Aldrich Cat: F9552 Clenbuterol Sigma-Aldrich Cat: C5423 Ascorbic acid Sigma-Aldrich Cat: A92902-25G TRIzol Thermo Fisher Scientific Cat: 15596026 (Continued on next page) Cell Reports 43, 113721, February 27, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays IL-17A Elisa Kit MEIMIAN Cat: MM-0759M1 IL-17F Elisa Kit MEIMIAN Cat: MM-1129M1 Experimental models: Organisms/strains Mouse: C57BL6/J The Jackson Laboratory RRID:IMSR JAX:000664 Mouse: Th-Cre The Jackson Laboratory RRID:IMSR_JAX:008601 Mouse: Adrb1 / Adrb2 / The Jackson Laboratory RRID:IMSR_JAX:003810 Mouse: Sarm1 / The Jackson Laboratory RRID:IMSR_JAX:018069 Mouse: Prf1 / The Jackson Laboratory RRID:IMSR_JAX:002407 Mouse: Tcrbd / The Jackson Laboratory RRID:IMSR_JAX: 002122 Mouse: Sarm1fl/fl Jing Yang Lab, Peking University Sun et al. 202130 Mouse: Tcrd-H2B-eGFP The Jackson Laboratory RRID:IMSR_JAX: 016941 Oligonucleotides Mouse Cyclophilin Q-PR F: TGGAGAGCACCAAGACAGACA Integrated DNA Technologies This paper Mouse Cyclophilin Q-PR R: TGCCGGAGTCGACAATGAT Integrated DNA Technologies This paper Mouse IL17A Q-PCR F: CAGGGAGAGCTTCATCTGTGT Integrated DNA Technologies This paper Mouse IL17A Q-PCR R: GCTGAGCTTTGAGGGATGAT Integrated DNA Technologies This paper Mouse IL17F Q-PCR F: CCCAGGAAGACATACTTAGAAGAAA Integrated DNA Technologies This paper Mouse IL17F Q-PCR R: GCAAGTCCCAACATCAACAG Integrated DNA Technologies This paper Software and Article Title: YTHDF1-CLOCK axis contributes to pathogenesis of allergic airway inflammation through LLPS. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies METTL3 Abcam ab195352 RRID:AB_2721254 METTL14 Abcam ab220030 RRID:AB_2893210 WTAP ABclonal A14695 RRID:AB_2761570 YTHDF1 Abcam ab252346 RRID:AB_252346 YTHDF1 Servicebio GB111390 YTHDF2 Abcam ab246514 RRID:AB_2891213 YTHDF3 Abcam ab220161 RRID:AB_2868574 CD326 Abcam ab71916 RRID:AB_1603782 CLOCK ABclonal A7265 RRID:AB_2863594 CRY2 ABclonal A17465 RRID:AB_2769052 PER2 ABclonal A5107 RRID:AB_2863447 PER3 ABclonal A2219 RRID:AB_2862977 CREB1 ABclonal A11064 RRID:AB 2758389 FBXL3 Abcam Ab96645 RRID:AB 10679381 TSLP Servicebio GB111664 IL-25 Abcam Ab115672 RRID:AB 10902345 IL-33 Affinity DF8369 RRID:AB 2841633 NLRP3 Cell Signaling Technology 1510S NLRP3 Servicebio GB11300 IL-1b Abcam Ab234437 RRID:AB 2936228 Biological samples Human bronchial biopsies samples This study N/A Chemicals, peptides, and recombinant proteins TRIZOL reagent Thermo Fisher scientific 15596018 LipoFectamine 3000 Thermo Fisher scientific L3000150 HaltTM protease and phosphatase inhibitor cocktail Thermo Fisher scientific MedChemExpress 78440 HY-K0021 Triton X-100 Beyotime P0096 RIPA Beyotime P0013B Magna RIPTM RNA-Binding Millipore 17–701 House Dust Mite Greer labs XPB82D3A25 PneumaCultTM -Ex Plus Medium STEMCELL Technologies 05040 PneumaCultTM-ALI Medium STEMCELL Technologies 05001 Pronase MedChemExpress HY-114158 penicillin/streptomycin Thermo Fisher Scientific 15140122 fungizone Thermo Fisher Scientific 15290026 Collagen I, Rat Tail Merck-Millipore 18080093 SYBRR Green PCR Master Mix Thermo Fisher Scientific 23225 DAPI Sigma-Aldrich D9542 Critical commercial assays FastQuant RT Kit TIANGEN KR106 PierceTM BCA Protein Assay Kit Thermo Fisher Scientific F6057 (Continued on next page) 16 Cell Reports 43, 113947, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data m6A-Seq, mRNA-Seq This study GSE256458, GSE256531 Experimental models: Cell lines Primary human AECs This study N/A Primary mouse AECs This study N/A BEAS-2B This study N/A Experimental models: Organisms/strains Mouse: C57/BL6 The Jackson Laboratory RRID:IMSR JAX:000664 Mouse: BALB/c The Jackson Laboratory RRID:MGI:2161072 Mouse: YTHDF1fl/fl N/A Mouse: Shhcre N/A Oligonucleotides Primers are listed in Table S2 This study N/A siRNA sequence are listed in Table S3 This study N/A Recombinant DNA YTHDF1-Flag This study N/A YTHDF1-YTH-mut This study N/A YTHDF1-C This study N/A BFP-YTHDF1-C This study N/A Software and Laser-Scanning Microscopy:Article Title: Hippocampal engram networks for fear memory recruit new synapses and modify pre-existing synapses in vivo. Article Snippet: .. Korea N/A Recombinant DNA pAAV-Fos-rtTA Choi et al.8 Addgene 120309 pAAV-CamKll-iCre Choi et al.8 N/A pAAV-EF1a-DIO-myriRFP670V5P2A-post-eGRASP Choi et al.8 Addgene 111585 pAAV-TRE3G-myrmScarlet-I This paper N/A pAAV-CamKll-cyan pre-eGRASP Choi et al.8 Addgene 111586 pAAV-TRE3G-yellow pre-eGRASP Choi et al.8 N/A Software and other:Article Title: Mycobacteria trehalose dimycolate interactions with host Mincle remodel blood-brain barrier junctions for brain invasion. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER JS485 (linearise pMV261 F primer sequence): CATTGCGAAGTGATTCCTCC This paper N/A JS486 (linearise pMV261 R primer sequence): TAGCGTACGATCGACTGC This paper N/A JS487 (amplify pknD Mm F primer sequence): TCCCCGATCCGGAGGAATCACTTCGCAA TGGTGAGCGAGACCGGGCCG This paper N/A JS488 (amplify pknD Mm R primer sequence): ATTTGATGCCTGGCAGTCGATCGTACGCTA TCAGGATCCTTGGGCCAGTTTCAG This paper N/A JS493 (linearise pTEC27 F primer sequence): CACTTTCTGGCTGGATGATG This paper N/A JS494 (linearise pTEC27 R primer sequence): CCACGGTTGATGAGAGCT This paper N/A JS495 (amplify hsp60:pknD Mm F primer sequence): CACCTACAACAAAGCTCTCATCAACCGTGGAAA TCTAGACGGTGACCACAACG This paper N/A JS496 (amplify hsp60:pknD Mm R primer sequence): TGAATCGCCCCATCATCCAGCCAGAAAGT GTTGTTGGCTAGCTGATCACC This paper N/A Recombinant DNA pTEC18 (msp12:eBFP2) Takaki et al., 2013 72 Addgene #30177 pTEC27 (msp12:tdTomato;hygR) Takaki et al., 2013 72 Addgene #30182 pTEC31 (msp12:tdTomato;kanR) Conrad et al., 2017 46 N/A pNitET-SacB-Kan Murphy et al., 2015 79 Addgene #107692 pKM461 Murphy et al., 2018 80 Addgene #108320 pCre-SacB-Zeo Murphy et al., 2015 79 Addgene #107706 pJKS146 (pKM464 [Addgene #108322] modified to have lox66/71 sites flanking attB) This paper N/A pJKS181 (pKM342 [Addgene #71486] with inserts to delete pknD) This paper N/A pJKS217 (pKM342 [Addgene #71486] with inserts to delete pcaA) This paper N/A pJKS226 (msp12:tdTomato;hsp60:pknD Mm ) This paper N/A gRNAs Mincle gRNA 1: GGTGAAGAGAAGCGTAACTT This paper N/A Mincle gRNA 2: GAGATCTGTGACACTCAAAT This paper N/A Mincle gRNA 3: AGCCTAACATGGGTCTGCAG This paper N/A Software and Article Title: RhoA GEF Mcf2lb regulates rosette integrity during collective cell migration Article Snippet: Key Resources Table Reagent or resource Source Identifier Primary Antibodies Monoclonal Mouse anti ZO-1 Invitrogen CAT# 33- 9100 Rabbit anti Rock-2a Anaspec N/A Polyclonal Rabbit anti pMRLC Cell Signaling Technology CAT# 3671 Experimental Models: Organisms/Strains Zebrafish: Wildtype-AB strain Zebrafish: Tg(-8.0claudinB: lynGFP) zf106 (Haas and Gilmour, 2006) N/A Zebrafish: Tg(prim:lyn2-mCherry) (Wang et al., 2018) N/A Zebrafish: TgBAC(cxcr4b:F-tractin-mCherry) (Yamaguchi et al., 2022) N/A Zebrafish: TgBAC (cxcr4b: LexPr,cryaa:GFP) (Durdu et al., 2014) N/A Zebrafish: TgBAC (cxcr4b:AHPH-GFP) (Qian et al., 2023; preprint) N/A Oligonucleotides CRISPR Guide Exon 6 5’aattaatacgactcactataggttatcatgctaagctcaggttttagagctag aaatagc 3’ Designed using Chop chop https://ch opchop.c bu.uib.no / CRISPR Guide Exon 10 5’aattaatacgactcactatagattggtcagctcttgaagggttttagagctag aaatagc 3’ Designed using Chop chop https://ch opchop.c bu.uib.no / CRISPR Guide Exon 21 5’aattaatacgactcactatagggctcagtggagctgcagggttttagagct agaaatagc 3’ Designed using Chop chop https://ch opchop.c bu.uib.no / mcf2lb in situ hybridization probe Forward: 5’GATGGAGCTCGCCAGGTTTA 3’ Reverse: 5’CCAAGCTTCTAATACGACTCACTATAGGGAGATCC CTCTCCTCTTCTGGGTC 3’ N/A N/A arhgef4 in situ hybridization probe Forward: 5’ GCTCAAGTACACCAACCCACA 3’ Reverse: 5’CCAAGCTTCTAATACGACTCACTATAGGGAGAAAC ACAAGTTCAGGCACCGAG 3’ N/A N/A twf2b in situ hybridization probe Forward: 5’ CACAGAGGACGAGCGAAGAAT 3’ Reverse: 5’ CCAAGCTTCTAATACGACTCACTATAGGGAGA GGCCTTGTAAACCATGCCAG 3’ N/A N/A fhdc1 in situ hybridization probe Forward: 5’AAAGCATGCCAGCCAGAAGA 3’ Reverse: 5’CCAAGCTTCTAATACGACTCACTATAGGGAGATTG CTGAGCATCTAGCAACAC N/A N/A buc positive control maternal contribution PCR Forward: 5’ GCAACCTCACCACCCAGTAA 3’ Reverse: 5’ GCATGGGTGCATGTGGAATC 3’ N/A N/A D ev el o pm en t • S up pl em en ta ry in fo rm at io n mcf2lb maternal contribution PCR: Forward: 5’ GAAGGAGTCGAGTCCCCTCT 3’ Reverse: 5’ CACTTGCAGTCTCTGAGCCA 3’ N/A N/A atoh1a in situ hybridization probe (Itoh and Chitnis, 2001) N/A deltaA in situ hybridization probe (Itoh and Chitnis, 2001) N/A Recombinant DNA Plasmid: Sp6-Par3-tagRFP-STOP (Gong et al., 2002; Rieger and Sagasti, 2011) N/A Plasmid: pDest-Cg2-LexOP-secGFP (Durdu et al., 2014) N/A Software and Plasmid Preparation:Article Title: An HNF1α truncation associated with maturity-onset diabetes of the young impairs pancreatic progenitor differentiation by antagonizing HNF1β function Article Snippet: .. This study N/A Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Addgene (Ran et al., 2013) plasmid #48138 pUltra backbone Addgene plasmid #24129 pMD2.G Addgene plasmid #12259 psPAX2 Addgene plasmid #12260 Software and Article Title: Neuroblastoma differentiation in vivo excludes cranial tumors. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-neurofilament heavy chain Genetex Cat# GTX110065; RRID: AB_1950985 Rabbit polyclonal anti-neurofilament heavy polypeptide Abcam Cat# ab8135; RRID: AB_306298 Goat polyclonal anti-RFP Rockland Cat# 200-101-379; RRID: AB_2744552 Rabbit polyclonal anti-ITSN1 antibody Russo and O’Bryan, 2012; Laboratory of John P. O’Bryan, Medical University of South Carolina N/A Mouse monoclonal anti-b-tubulin antibody Sigma-Aldrich Cat# T4026; RRID: AB_477577 Alexa Fluor 488 donkey anti-mouse IgG (H+L) ThermoFisher REF# A21202; RRID: AB_141607 Alexa Fluor 488 donkey anti-rabbit IgG (H+L) ThermoFisher REF# A21206; RRID: AB_2535792 Alexa Fluor 647 donkey anti-goat IgG (H+L) ThermoFisher REF# A21447; RRID: AB_2535864 Alexa Fluor 647 donkey anti-mouse IgG (H+L) ThermoFisher REF# A31571; RRID: AB_162542 Alexa Fluor 647 donkey anti-rabbit IgG (H+L) ThermoFisher REF# A31573; RRID: AB_2536183 Biological samples Patient-derived xenografts (PDXs) Children’s Oncology Group Childhood Cancer Repository COG557x; COG636x Chemicals, peptides, and recombinant proteins Lipofectamine 3000 Transfection Reagent Invitrogen Cat# L3000001 Retinoic acid Sigma-Aldrich Cat# R2625 ANA-12 Sigma-Aldrich Cat# SML0209 K252a Sigma-Aldrich Cat# K1639 LY294002 Sigma-Aldrich Cat# 440202 Wortmannin Sigma-Aldrich Cat# W1628 Agarose, low gelling temperature Sigma-Aldrich Cat# A0701 Tricaine/MS-222 Sigma-Aldrich Cat# A5040 Methyl cellulose Sigma-Aldrich Cat# M0512 BDNF human Sigma-Aldrich Cat# SRP3014 Triethanolamine Sigma-Aldrich Cat# 90279 Formamide Sigma-Aldrich Cat# F7503 DAPI Sigma-Aldrich Cat# D9542 Hoechst 34580 Invitrogen Cat# H21486 CellTracker CM-DiI Dye Invitrogen Cat# C7001 KnockOut DMEM Invitrogen Cat# 10829018 KnockOut Serum Replacement Invitrogen Cat# 10828028 N-2 Supplement Invitrogen Cat# 17502048 Critical commercial assays Hybridization Chain Reaction Probes and Hairpins Version 3 Molecular Instruments N/A Experimental models: Cell lines HEK293 Laboratory of John P. O’Bryan, Medical University of South Carolina N/A (Continued on next page) Developmental Cell 56, 2752–2764.e1–e6, October 11, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SK-N-AS Laboratory of John P. O’Bryan, Medical University of South Carolina N/A KELLY Laboratory of John P. O’Bryan, Medical University of South Carolina N/A SH-SY5Y Laboratory of Gerardo Morfini, University of Illinois at Chicago N/A IMR-5 Laboratory of John P. O’Bryan, Medical University of South Carolina N/A A375 American Type Culture Collection Cat# CRL-1619 OVCAR-8 Laboratory of Joanna E Burdette, University of Illinois at Chicago N/A GIMEN Biohippo Cat# 300179 Experimental models: Organisms/strains Zebrafish: AB wild-type ZIRC Cat# ZL1 Zebrafish: Tg(-4.9sox10:eGFP) Wada et al., 2005 ZFIN ID: ZDB-FISH-150901-15643 Mouse: C57BL/6J Jackson Labs Cat# 000664 Oligonucleotides Translation-blocking morpholino against BDNF: CCAGTCGTAAAGGAGACCATTCAGC Diekmann et al., 2009 N/A Control morpholino: CCTCTTACCTCAGTTACAATTTATA Gene Tools SKU:PCO-StandardControl-100 Recombinant DNA mCherry-Farnesyl-5 Laboratory of Michael Davidson, The Florida State University Addgene plasmid # 55045 mCherry-Lifeact-7 Laboratory of Michael Davidson, The Florida State University Addgene plasmid # 54491 GFP-AktPH Laboratory of Tobias Meyer, Stanford University (Haugh et al., 2000) N/A -2.2NEUROD1:eGFP This paper N/A murine ITSN1s-CFP This paper N/A Software and Control:Article Title: Neuroblastoma differentiation in vivo excludes cranial tumors. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-neurofilament heavy chain Genetex Cat# GTX110065; RRID: AB_1950985 Rabbit polyclonal anti-neurofilament heavy polypeptide Abcam Cat# ab8135; RRID: AB_306298 Goat polyclonal anti-RFP Rockland Cat# 200-101-379; RRID: AB_2744552 Rabbit polyclonal anti-ITSN1 antibody Russo and O’Bryan, 2012; Laboratory of John P. O’Bryan, Medical University of South Carolina N/A Mouse monoclonal anti-b-tubulin antibody Sigma-Aldrich Cat# T4026; RRID: AB_477577 Alexa Fluor 488 donkey anti-mouse IgG (H+L) ThermoFisher REF# A21202; RRID: AB_141607 Alexa Fluor 488 donkey anti-rabbit IgG (H+L) ThermoFisher REF# A21206; RRID: AB_2535792 Alexa Fluor 647 donkey anti-goat IgG (H+L) ThermoFisher REF# A21447; RRID: AB_2535864 Alexa Fluor 647 donkey anti-mouse IgG (H+L) ThermoFisher REF# A31571; RRID: AB_162542 Alexa Fluor 647 donkey anti-rabbit IgG (H+L) ThermoFisher REF# A31573; RRID: AB_2536183 Biological samples Patient-derived xenografts (PDXs) Children’s Oncology Group Childhood Cancer Repository COG557x; COG636x Chemicals, peptides, and recombinant proteins Lipofectamine 3000 Transfection Reagent Invitrogen Cat# L3000001 Retinoic acid Sigma-Aldrich Cat# R2625 ANA-12 Sigma-Aldrich Cat# SML0209 K252a Sigma-Aldrich Cat# K1639 LY294002 Sigma-Aldrich Cat# 440202 Wortmannin Sigma-Aldrich Cat# W1628 Agarose, low gelling temperature Sigma-Aldrich Cat# A0701 Tricaine/MS-222 Sigma-Aldrich Cat# A5040 Methyl cellulose Sigma-Aldrich Cat# M0512 BDNF human Sigma-Aldrich Cat# SRP3014 Triethanolamine Sigma-Aldrich Cat# 90279 Formamide Sigma-Aldrich Cat# F7503 DAPI Sigma-Aldrich Cat# D9542 Hoechst 34580 Invitrogen Cat# H21486 CellTracker CM-DiI Dye Invitrogen Cat# C7001 KnockOut DMEM Invitrogen Cat# 10829018 KnockOut Serum Replacement Invitrogen Cat# 10828028 N-2 Supplement Invitrogen Cat# 17502048 Critical commercial assays Hybridization Chain Reaction Probes and Hairpins Version 3 Molecular Instruments N/A Experimental models: Cell lines HEK293 Laboratory of John P. O’Bryan, Medical University of South Carolina N/A (Continued on next page) Developmental Cell 56, 2752–2764.e1–e6, October 11, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SK-N-AS Laboratory of John P. O’Bryan, Medical University of South Carolina N/A KELLY Laboratory of John P. O’Bryan, Medical University of South Carolina N/A SH-SY5Y Laboratory of Gerardo Morfini, University of Illinois at Chicago N/A IMR-5 Laboratory of John P. O’Bryan, Medical University of South Carolina N/A A375 American Type Culture Collection Cat# CRL-1619 OVCAR-8 Laboratory of Joanna E Burdette, University of Illinois at Chicago N/A GIMEN Biohippo Cat# 300179 Experimental models: Organisms/strains Zebrafish: AB wild-type ZIRC Cat# ZL1 Zebrafish: Tg(-4.9sox10:eGFP) Wada et al., 2005 ZFIN ID: ZDB-FISH-150901-15643 Mouse: C57BL/6J Jackson Labs Cat# 000664 Oligonucleotides Translation-blocking morpholino against BDNF: CCAGTCGTAAAGGAGACCATTCAGC Diekmann et al., 2009 N/A Control morpholino: CCTCTTACCTCAGTTACAATTTATA Gene Tools SKU:PCO-StandardControl-100 Recombinant DNA mCherry-Farnesyl-5 Laboratory of Michael Davidson, The Florida State University Addgene plasmid # 55045 mCherry-Lifeact-7 Laboratory of Michael Davidson, The Florida State University Addgene plasmid # 54491 GFP-AktPH Laboratory of Tobias Meyer, Stanford University (Haugh et al., 2000) N/A -2.2NEUROD1:eGFP This paper N/A murine ITSN1s-CFP This paper N/A Software and Enzyme-linked Immunosorbent Assay:Article Title: An axon-T cell feedback loop enhances inflammation and axon degeneration. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Mouse PGP9.5 ProteinTech Group RRID:AB_2210497 Anti-Mouse Tyrosine Hydroxylase Millipore RRID:AB_390204 Anti-Mouse CD45 PE-Cy7 Biolegend RRID: AB_312979 Anti-Mouse CD3 Brilliant Violet 421 Biolegend RRID: AB_10900227 Anti-Mouse CD3 PE Biolegend RRID: AB_312663 Anti-Mouse gd TCR FITC Biolegend RRID: AB_313830 Anti-Mouse IL17A APC eBioscience RRID: AB_763580 Donkey anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen RRID: AB 2536183 Donkey anti-Chicken IgY (H + L) Highly Cross Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen RRID: AB_2921074 Donkey anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 790 Invitrogen RRID: AB_2534145 Donkey anti-Rat IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 Invitrogen RRID: AB 2910653 Goat anti-Armenian Hamster IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen RRID: AB_2925790 InVivoMAb anti-mouse CD8a BioXCell Cat: BE0004- InVivoMAb anti-mouse TCR g/d BioXCell Cat: BE0070 InVivoMAb rat IgG2a isotype control BioXCell Cat: BE0089 InVivoMAb polyclonal Armenian hamster IgG BioXCell Cat: BE0091 Fc Block eBioscience RRID: AB_468582 Chemicals, peptides, and recombinant proteins Imiquimod Cream Padagis Israel Pharmaceuticals Ltd N/A 6-Hydroxydopamine (6-OHDA) Sigma-Aldrich Cat: 162957-50MG Nair Hair Removal Lotion Church & Dwight Co., Inc. N/A PrimeScript RT Reagent Kit Takara Cat: RR047A PowerUp SYBR Green Master Mix for qPCR Thermo Fisher Scientific Cat: A25742 Dispase II Sigma Aldrich Cat: D4693-1G Collagenase IV Sigma-Aldrich Cat: V900893 Hyaluronidase Sigma-Aldrich Cat: H3884-100MG DNAse I Sigma-Aldrich Cat: D5025-15KU Phorbol-12-Myristate-13-Acetate Santa Cruz Biotechnology Cat: sc-3576 Ionomycin MP Biomedicals Inc Cat: 02155070-CF Norepinephrine Sigma-Aldrich Cat: A7256-1G Formoterol Sigma-Aldrich Cat: F9552 Clenbuterol Sigma-Aldrich Cat: C5423 Ascorbic acid Sigma-Aldrich Cat: A92902-25G TRIzol Thermo Fisher Scientific Cat: 15596026 (Continued on next page) Cell Reports 43, 113721, February 27, 2024 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays IL-17A Elisa Kit MEIMIAN Cat: MM-0759M1 IL-17F Elisa Kit MEIMIAN Cat: MM-1129M1 Experimental models: Organisms/strains Mouse: C57BL6/J The Jackson Laboratory RRID:IMSR JAX:000664 Mouse: Th-Cre The Jackson Laboratory RRID:IMSR_JAX:008601 Mouse: Adrb1 / Adrb2 / The Jackson Laboratory RRID:IMSR_JAX:003810 Mouse: Sarm1 / The Jackson Laboratory RRID:IMSR_JAX:018069 Mouse: Prf1 / The Jackson Laboratory RRID:IMSR_JAX:002407 Mouse: Tcrbd / The Jackson Laboratory RRID:IMSR_JAX: 002122 Mouse: Sarm1fl/fl Jing Yang Lab, Peking University Sun et al. 202130 Mouse: Tcrd-H2B-eGFP The Jackson Laboratory RRID:IMSR_JAX: 016941 Oligonucleotides Mouse Cyclophilin Q-PR F: TGGAGAGCACCAAGACAGACA Integrated DNA Technologies This paper Mouse Cyclophilin Q-PR R: TGCCGGAGTCGACAATGAT Integrated DNA Technologies This paper Mouse IL17A Q-PCR F: CAGGGAGAGCTTCATCTGTGT Integrated DNA Technologies This paper Mouse IL17A Q-PCR R: GCTGAGCTTTGAGGGATGAT Integrated DNA Technologies This paper Mouse IL17F Q-PCR F: CCCAGGAAGACATACTTAGAAGAAA Integrated DNA Technologies This paper Mouse IL17F Q-PCR R: GCAAGTCCCAACATCAACAG Integrated DNA Technologies This paper Software and Sequencing:Article Title: YTHDF1-CLOCK axis contributes to pathogenesis of allergic airway inflammation through LLPS. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies METTL3 Abcam ab195352 RRID:AB_2721254 METTL14 Abcam ab220030 RRID:AB_2893210 WTAP ABclonal A14695 RRID:AB_2761570 YTHDF1 Abcam ab252346 RRID:AB_252346 YTHDF1 Servicebio GB111390 YTHDF2 Abcam ab246514 RRID:AB_2891213 YTHDF3 Abcam ab220161 RRID:AB_2868574 CD326 Abcam ab71916 RRID:AB_1603782 CLOCK ABclonal A7265 RRID:AB_2863594 CRY2 ABclonal A17465 RRID:AB_2769052 PER2 ABclonal A5107 RRID:AB_2863447 PER3 ABclonal A2219 RRID:AB_2862977 CREB1 ABclonal A11064 RRID:AB 2758389 FBXL3 Abcam Ab96645 RRID:AB 10679381 TSLP Servicebio GB111664 IL-25 Abcam Ab115672 RRID:AB 10902345 IL-33 Affinity DF8369 RRID:AB 2841633 NLRP3 Cell Signaling Technology 1510S NLRP3 Servicebio GB11300 IL-1b Abcam Ab234437 RRID:AB 2936228 Biological samples Human bronchial biopsies samples This study N/A Chemicals, peptides, and recombinant proteins TRIZOL reagent Thermo Fisher scientific 15596018 LipoFectamine 3000 Thermo Fisher scientific L3000150 HaltTM protease and phosphatase inhibitor cocktail Thermo Fisher scientific MedChemExpress 78440 HY-K0021 Triton X-100 Beyotime P0096 RIPA Beyotime P0013B Magna RIPTM RNA-Binding Millipore 17–701 House Dust Mite Greer labs XPB82D3A25 PneumaCultTM -Ex Plus Medium STEMCELL Technologies 05040 PneumaCultTM-ALI Medium STEMCELL Technologies 05001 Pronase MedChemExpress HY-114158 penicillin/streptomycin Thermo Fisher Scientific 15140122 fungizone Thermo Fisher Scientific 15290026 Collagen I, Rat Tail Merck-Millipore 18080093 SYBRR Green PCR Master Mix Thermo Fisher Scientific 23225 DAPI Sigma-Aldrich D9542 Critical commercial assays FastQuant RT Kit TIANGEN KR106 PierceTM BCA Protein Assay Kit Thermo Fisher Scientific F6057 (Continued on next page) 16 Cell Reports 43, 113947, March 26, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data m6A-Seq, mRNA-Seq This study GSE256458, GSE256531 Experimental models: Cell lines Primary human AECs This study N/A Primary mouse AECs This study N/A BEAS-2B This study N/A Experimental models: Organisms/strains Mouse: C57/BL6 The Jackson Laboratory RRID:IMSR JAX:000664 Mouse: BALB/c The Jackson Laboratory RRID:MGI:2161072 Mouse: YTHDF1fl/fl N/A Mouse: Shhcre N/A Oligonucleotides Primers are listed in Table S2 This study N/A siRNA sequence are listed in Table S3 This study N/A Recombinant DNA YTHDF1-Flag This study N/A YTHDF1-YTH-mut This study N/A YTHDF1-C This study N/A BFP-YTHDF1-C This study N/A Software and |